Summary
| Resource Type | Gene |
|---|---|
| Accession | |
| Organism | |
| Name | Pa08g2505 |
| Identifier | Pa08g2505 |
| Is Analysis | No |
| Is Obsolete | No |
| Time Accessioned | Friday, October 2, 2026 - 02:37 |
| Time Last Modified | Friday, October 2, 2026 - 02:37 |
Sequences
| Sequence | ATGAACAAGGAAGTTCCAGGGAATTATGTGGAGACTGCAACATTGTCAAA |
|---|---|
| Sequence Length | 61467 |
| Sequence Checksum | 2f6ddced2f3f1ceb5f99afe4859d45a8 |
| Sequence Coordinates | Pa08:57238105..57299571- |
Annotations
| Term | Name | Definition |
|---|---|---|
| There are no annotations of this type | ||
Relationship

| Relationships |
|---|
| The mRNA, Pa08g2505.6, is a part of gene, Pa08g2505. |
| The mRNA, Pa08g2505.5, is a part of gene, Pa08g2505. |
| The mRNA, Pa08g2505.4, is a part of gene, Pa08g2505. |
| The mRNA, Pa08g2505.3, is a part of gene, Pa08g2505. |
| The mRNA, Pa08g2505.2, is a part of gene, Pa08g2505. |
| The mRNA, Pa08g2505.1, is a part of gene, Pa08g2505. |

Transcripts
| Transcript Name | Identifier | Type | Location |
|---|---|---|---|
| Pa08g2505.1 | Pa08g2505.1 | mRNA | Pa08:57238104..57285297 |
| Pa08g2505.2 | Pa08g2505.2 | mRNA | Pa08:57270530..57271974 |
| Pa08g2505.3 | Pa08g2505.3 | mRNA | Pa08:57270530..57285297 |
| Pa08g2505.4 | Pa08g2505.4 | mRNA | Pa08:57279681..57299571 |
| Pa08g2505.5 | Pa08g2505.5 | mRNA | Pa08:57294698..57299571 |
| Pa08g2505.6 | Pa08g2505.6 | mRNA | Pa08:57299187..57299571 |