Summary
| Resource Type | Gene |
|---|---|
| Accession | |
| Organism | |
| Name | Pa06g2312 |
| Identifier | Pa06g2312 |
| Is Analysis | No |
| Is Obsolete | No |
| Time Accessioned | Thursday, October 29, 2026 - 23:49 |
| Time Last Modified | Thursday, October 29, 2026 - 23:49 |
Sequences
| Sequence | ATGGAGAGTTTTTTAGCATGGATTGGTCAGATGATTCCAACTCCTCAGAT |
|---|---|
| Sequence Length | 190359 |
| Sequence Checksum | 2cc2858cee7139a008006d0b7d3d6b89 |
| Sequence Coordinates | Pa06:53671048..53861406+ |
Annotations
| Term | Name | Definition |
|---|---|---|
| There are no annotations of this type | ||
Relationship
| Relationships |
|---|
| The mRNA, Pa06g2312.1, is a part of gene, Pa06g2312. |
| The mRNA, Pa06g2312.2, is a part of gene, Pa06g2312. |
| The mRNA, Pa06g2312.4, is a part of gene, Pa06g2312. |
| The mRNA, Pa06g2312.3, is a part of gene, Pa06g2312. |
| The mRNA, Pa06g2312.5, is a part of gene, Pa06g2312. |
| The mRNA, Pa06g2312.6, is a part of gene, Pa06g2312. |
| The mRNA, Pa06g2312.7, is a part of gene, Pa06g2312. |
| The mRNA, Pa06g2312.8, is a part of gene, Pa06g2312. |
| The mRNA, Pa06g2312.9, is a part of gene, Pa06g2312. |
Transcripts
| Transcript Name | Identifier | Type | Location |
|---|---|---|---|
| Pa06g2312.1 | Pa06g2312.1 | mRNA | Pa06:53671047..53673900 |
| Pa06g2312.2 | Pa06g2312.2 | mRNA | Pa06:53671047..53849108 |
| Pa06g2312.4 | Pa06g2312.4 | mRNA | Pa06:53671047..53861406 |
| Pa06g2312.3 | Pa06g2312.3 | mRNA | Pa06:53671047..53861406 |
| Pa06g2312.5 | Pa06g2312.5 | mRNA | Pa06:53671704..53675870 |
| Pa06g2312.6 | Pa06g2312.6 | mRNA | Pa06:53691381..53695073 |
| Pa06g2312.7 | Pa06g2312.7 | mRNA | Pa06:53857556..53861406 |
| Pa06g2312.8 | Pa06g2312.8 | mRNA | Pa06:53857556..53861406 |
| Pa06g2312.9 | Pa06g2312.9 | mRNA | Pa06:53858111..53861406 |
