Summary
| Resource Type | Gene |
|---|---|
| Accession | |
| Organism | |
| Name | Pa01g0358 |
| Identifier | Pa01g0358 |
| Is Analysis | No |
| Is Obsolete | No |
| Time Accessioned | Tuesday, October 6, 2026 - 14:34 |
| Time Last Modified | Tuesday, October 6, 2026 - 14:34 |
Sequences
| Sequence | ATGCCCCCCTCCATGACTGGGATGTTCATGGCTTATGTTACAGCTTCTTC |
|---|---|
| Sequence Length | 15359 |
| Sequence Checksum | 28e3258903d04edd8559e98c126e124c |
| Sequence Coordinates | Pa01:4561176..4576534+ |
Annotations
| Term | Name | Definition |
|---|---|---|
| There are no annotations of this type | ||
Relationship

| Relationships |
|---|
| The mRNA, Pa01g0358.1, is a part of gene, Pa01g0358. |
| The mRNA, Pa01g0358.2, is a part of gene, Pa01g0358. |
| The mRNA, Pa01g0358.3, is a part of gene, Pa01g0358. |
| The mRNA, Pa01g0358.4, is a part of gene, Pa01g0358. |
| The mRNA, Pa01g0358.5, is a part of gene, Pa01g0358. |
| The mRNA, Pa01g0358.6, is a part of gene, Pa01g0358. |

Transcripts
| Transcript Name | Identifier | Type | Location |
|---|---|---|---|
| Pa01g0358.1 | Pa01g0358.1 | mRNA | Pa01:4561175..4562549 |
| Pa01g0358.2 | Pa01g0358.2 | mRNA | Pa01:4561187..4562549 |
| Pa01g0358.3 | Pa01g0358.3 | mRNA | Pa01:4561187..4576534 |
| Pa01g0358.4 | Pa01g0358.4 | mRNA | Pa01:4569325..4572186 |
| Pa01g0358.5 | Pa01g0358.5 | mRNA | Pa01:4569325..4575827 |
| Pa01g0358.6 | Pa01g0358.6 | mRNA | Pa01:4569325..4576534 |