Summary
| Resource Type | Gene |
|---|---|
| Accession | |
| Organism | |
| Name | Pa01g0165 |
| Identifier | Pa01g0165 |
| Is Analysis | No |
| Is Obsolete | No |
| Time Accessioned | Friday, October 2, 2026 - 04:12 |
| Time Last Modified | Friday, October 2, 2026 - 04:12 |
Sequences
| Sequence | ATGGCTGAAGGTTCTATCTCGAGCCATAATGTAAGAGAGTATCAAGGACG |
|---|---|
| Sequence Length | 4558 |
| Sequence Checksum | bc694cee2ecc7a44b8c82ec4ded0dc2f |
| Sequence Coordinates | Pa01:1814162..1818719- |
Annotations
| Term | Name | Definition |
|---|---|---|
| There are no annotations of this type | ||
Relationship

| Relationships |
|---|
| The mRNA, Pa01g0165.6, is a part of gene, Pa01g0165. |
| The mRNA, Pa01g0165.5, is a part of gene, Pa01g0165. |
| The mRNA, Pa01g0165.4, is a part of gene, Pa01g0165. |
| The mRNA, Pa01g0165.3, is a part of gene, Pa01g0165. |
| The mRNA, Pa01g0165.2, is a part of gene, Pa01g0165. |
| The mRNA, Pa01g0165.1, is a part of gene, Pa01g0165. |

Transcripts
| Transcript Name | Identifier | Type | Location |
|---|---|---|---|
| Pa01g0165.1 | Pa01g0165.1 | mRNA | Pa01:1814161..1814884 |
| Pa01g0165.2 | Pa01g0165.2 | mRNA | Pa01:1814161..1817736 |
| Pa01g0165.3 | Pa01g0165.3 | mRNA | Pa01:1814161..1818269 |
| Pa01g0165.4 | Pa01g0165.4 | mRNA | Pa01:1817529..1817736 |
| Pa01g0165.5 | Pa01g0165.5 | mRNA | Pa01:1817827..1818719 |
| Pa01g0165.6 | Pa01g0165.6 | mRNA | Pa01:1818295..1818719 |